Class TestCasesStructuralTranslocations

java.lang.Object
org.snpeff.snpEffect.testCases.unity.TestCasesStructuralTranslocations

public class TestCasesStructuralTranslocations extends Object
Test case for structural variants: Translocation (fusions)

We create two genes (one transcript each). Each gene is in one different chromosome

Transcripts: 1:10-90, strand: +, id:tr1, Protein Exons: 1:10-30 'exon1', rank: 1, frame: ., sequence: tatttgtatgaggatttgagt 1:40-90 'exon2', rank: 2, frame: ., sequence: tactcagtgctgggcaatcccttagctgtcgcgccgcttaccctactattc CDS : tatttgtatgaggatttgagttactcagtgctgggcaatcccttagctgtcgcgccgcttaccctactattc Protein : YLYEDLSYSVLGNPLAVAPLTLLF

2:110-190, strand: +, id:tr2, Protein Exons: 2:110-125 'exon3', rank: 1, frame: ., sequence: gttaatgggatttcac 2:150-190 'exon4', rank: 2, frame: ., sequence: atgggaacggagtgtcgacagcaccttatggggagctatat CDS : gttaatgggatttcacatgggaacggagtgtcgacagcaccttatggggagctatat Protein : VNGISHGNGVSTAPYGELY

Genes diagram:

[ Chr1: Gene1 ] >>>>>>>>>>>>>>>>>>>>>--------->>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> | | | | ^10 ^30 ^40 ^90

[ Chr2: Gene2 ] >>>>>>>>>>>>>>>>------------------------>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> | | | | ^110 ^125 ^150 ^190

  • Constructor Details

    • TestCasesStructuralTranslocations

      public TestCasesStructuralTranslocations()
  • Method Details

    • checkEffects

      protected void checkEffects(Variant variant, EffectType[] expEffs, EffectType[] notExpEffs, String[] expHgvsp, String[] expHgvsc, VariantEffect.EffectImpact expectedImpact)
    • init

      public void init(boolean gene1NegativeStrand, boolean gene2NegativeStrand)
    • test01_0

      @Test public void test01_0()
      Translocation in the same direction (both genes in positive strand)

      #CHROM POS ID REF ALT chr1 35 . N N[chr2:140[

      gene1: >>>>>>>>>>>---- | gene2 ---->>>>>>>>>

    • test01_0_nonFs

      @Test public void test01_0_nonFs()
      Translocation in the same direction (both genes in positive strand)

      #CHROM POS ID REF ALT chr1 35 . N N[chr2:140[

      gene1: >>>>>>>>>>>---- | gene2 ---->>>>>>>>>>>>---

    • test01_1

      @Test public void test01_1()
      Translocation in opposite directions

      #CHROM POS ID REF ALT chr1 35 . N N[chr2:140[

      gene1: >>>>>>>>>>>---- | gene2 ----<<<<<<<<<<<<---

    • test01_2

      @Test public void test01_2()
      Translocation in opposite directions

      #CHROM POS ID REF ALT chr1 35 . N N[chr2:140[

      gene1: <<<<<<<<<<<<---- | gene2 ---->>>>>>>>>----

    • test01_3

      @Test public void test01_3()
      Translocation in the same direction (both genes in negative strand)

      #CHROM POS ID REF ALT chr1 35 . N N[chr2:140[

      gene1: <<<<<<<<<<<<---- | gene2 ----<<<<<<<<<<<<---

    • test01_3_noFs

      @Test public void test01_3_noFs()
      Translocation in the same direction (both genes in negative strand)

      #CHROM POS ID REF ALT chr1 35 . N N[chr2:140[

      gene1: <<<<<<<<<<<<---- | gene2 --<<<<<<<<<<<<---

    • test02_0

      @Test public void test02_0()
      Translocation in opposite directions (both genes in positive strand)

      #CHROM POS ID REF ALT chr1 35 . N N]chr2:140]

      gene1: >>>>>>>>>>>---- | gene2 >>>>>>>>>>>----

    • test02_1

      @Test public void test02_1()
      Translocation in the same direction

      #CHROM POS ID REF ALT chr1 35 . N N]chr2:140]

      gene1: >>>>>>>>>>>---- | gene2 <<<<<<<<<<<----

    • test02_1_nonFs

      @Test public void test02_1_nonFs()
      Translocation in the same direction

      #CHROM POS ID REF ALT chr1 35 . N N]chr2:140]

      gene1: >>>>>>>>>>>---- | gene2 -----<<<<<<<<<<<----

    • test02_2

      @Test public void test02_2()
      Translocation in the same direction

      #CHROM POS ID REF ALT chr1 35 . N N]chr2:140]

      gene1: <<<<<<<<<<<---- | gene2 >>>>>>>>>>>----

    • test02_2_nonFs

      @Test public void test02_2_nonFs()
      Translocation in the same direction

      #CHROM POS ID REF ALT chr1 35 . N N]chr2:140]

      gene1: <<<<<<<<<<<---- | gene2 ----->>>>>>>>>>>----

    • test02_3

      @Test public void test02_3()
      Translocation in the opposite directions

      #CHROM POS ID REF ALT chr1 35 . N N]chr2:140]

      gene1: <<<<<<<<<<<---- | gene2 <<<<<<<<<<<----

    • test03_0

      @Test public void test03_0()
      Translocation in opposite directions

      #CHROM POS ID REF ALT chr1 35 . N [chr2:140[N

      gene1: --->>>>>>>>>>>---- | gene2 --->>>>>>>>>>>----

    • test03_1

      @Test public void test03_1()
      Translocation in the same direction

      #CHROM POS ID REF ALT chr1 35 . N [chr2:140[N

      gene1: --->>>>>>>>>>>---- | gene2 ---<<<<<<<<<<----

    • test03_1_nonFs

      @Test public void test03_1_nonFs()
      Translocation in the same direction

      #CHROM POS ID REF ALT chr1 35 . N [chr2:140[N

      gene1: --->>>>>>>>>>>---- | gene2 ---<<<<<<<<<<----

    • test03_2

      @Test public void test03_2()
      Translocation in the same direction

      #CHROM POS ID REF ALT chr1 35 . N [chr2:140[N

      gene1: ---<<<<<<<<<<<---- | gene2 --->>>>>>>>>>>----

    • test03_2_nonFs

      @Test public void test03_2_nonFs()
      Translocation in the same direction

      #CHROM POS ID REF ALT chr1 35 . N [chr2:140[N

      gene1: ---<<<<<<<<<<<---- | gene2 >>>>>>>>>>>----

    • test03_3

      @Test public void test03_3()
      Translocation in the opposite directions

      #CHROM POS ID REF ALT chr1 35 . N [chr2:140[N

      gene1: ---<<<<<<<<<<<---- | gene2 ---<<<<<<<<<<<----

    • test04_0

      @Test public void test04_0()
      Translocation in the same direction (both genes in positive strand)

      #CHROM POS ID REF ALT chr1 35 . N ]chr2:140]N

      gene1: --->>>>>>>>>>>---- | gene2 --->>>>>>>>>>>----

    • test04_0_nonFs

      @Test public void test04_0_nonFs()
      Translocation in the same direction (both genes in positive strand)

      #CHROM POS ID REF ALT chr1 35 . N ]chr2:140]N

      gene1: --->>>>>>>>>>>---- | gene2 --->>>>>>>>>>>

    • test04_1

      @Test public void test04_1()
      Translocation in opposite directions

      #CHROM POS ID REF ALT chr1 35 . N ]chr2:140]N

      gene1: --->>>>>>>>>>>---- | gene2 ---<<<<<<<<<<<----

    • test04_2

      @Test public void test04_2()
      Translocation in opposite directions

      #CHROM POS ID REF ALT chr1 35 . N ]chr2:140]N

      gene1: ---<<<<<<<<<<<<<<---- | gene2 --->>>>>>>>>>>----

    • test04_3

      @Test public void test04_3()
      Translocation in the same direction

      #CHROM POS ID REF ALT chr1 35 . N ]chr2:140]N

      gene1: ---<<<<<<<<<<<<---- | gene2 ---<<<<<<<<<<<----

    • test04_3_nonFs

      @Test public void test04_3_nonFs()
      Translocation in the same direction

      #CHROM POS ID REF ALT chr1 35 . N ]chr2:140]N

      gene1: ---<<<<<<<<<<<<---- | gene2 ---<<<<<<<<<<<----

    • test05_1_one_gene

      @Test public void test05_1_one_gene()
      Translocation affecting a gene and an intergenic region

      [ Chr1: Gene1 ] ......>>>>>>>>>>>>>>>>>>>>>--------->>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>.............................................................................................................. ^10 ^30 | ^40 ^90 | |> ------------------ <| | | ..........................................................................................................>>>>>>>>>>>>>>>>------------------------>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>.......... ^110 ^125 ^150 ^190 [ Chr2: Gene2 ]

    • test05_2_one_gene

      @Test public void test05_2_one_gene()
      Translocation affecting a gene and an intergenic region

      [ Chr1: Gene1 ] ......>>>>>>>>>>>>>>>>>>>>>--------->>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>.............................................................................................................. ^10 ^30 ^40 ^90 | |> ------------ <| | ..........................................................................................................>>>>>>>>>>>>>>>>------------------------>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>.......... ^110 ^125 ^150 ^190 [ Chr2: Gene2 ]

    • test06_no_gene

      @Test public void test06_no_gene()
      Translocation not affecting any gene (intergenic regions)

      [ Chr1: Gene1 ] ......>>>>>>>>>>>>>>>>>>>>>--------->>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>.............................................................................................................. ^10 ^30 ^40 ^90 | <|------------------------------------------------------------------------------------|> | ..........................................................................................................>>>>>>>>>>>>>>>>------------------------>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>.......... ^110 ^125 ^150 ^190 [ Chr2: Gene2 ]