Package org.snpeff.snpEffect.testCases.unity
package org.snpeff.snpEffect.testCases.unity
-
ClassesClassDescriptiontest cases for Sequence alignmentTest case for parsing ANN fieldsTest cases: apply a variant (DEL) to a transcriptTest cases: apply a variant (INS) to a transcriptTest cases: apply a variant (MIXED) to a transcriptTest cases: apply a variant (MNP) to a transcriptTest cases: apply a variant (SNP) to a transcriptBase class for some test casesTest caseTest for Binomial distributionTest caseTest random SNP changesTest for Hypergeometric distribution and Fisher exact testTest cases for circular genomesCochran-Armitage test statistic test caseCodon tablesTest case for cytobandsTest random DEL changesTest random DEL changesTest Splice sites variantsTest caseTest case for FASTA file parsingTest cases for file index (chr:pos index on files)Test for Hypergeometric distribution and Fisher exact testGenePvalueList statistics test caseTest caseTest cases for GenotypeVector classTest case for basic HGV annotationsTest caseTest cases for HGVS's 'dup' on the negative strandTest random SNP changesTest random SNP changesTest caseTest for Hypergeometric distribution and Fisher exact testTest random SNP changesTest intergenic markersTest case for interval tree structureTest case for interval tree structureTest case for interval tree structureTest random Interval Variants (e.g.Test case for Jaspar parsingTest random SNP changesTest cases for protein interactionTest Reactome circuitsSeekable file reader test caseTest random SNP changesTest Splice sites variantsTest Splice sites variantsTest case Gene: geneId1 1:957-1157, strand: +, id:transcript_0, Protein Exons: 1:957-988 'exon_0_0', rank: 1, frame: ., sequence: gttgcttgaatactgtatagccttgccattgt 1:1045-1057 'exon_0_1', rank: 2, frame: ., sequence: tgtgttgctaact 1:1148-1157 'exon_0_2', rank: 3, frame: ., sequence: agacatggac CDS : gttgcttgaatactgtatagccttgccattgttgtgttgctaactagacatggac Protein : VA*ILYSLAIVVLLTRHG?Test case for structural variants: DuplicationsTest cases for structural variants: InversionsTest case for structural variants: Translocation (fusions)Test cases: apply a variant (MIXED) to a transcriptTest cases for variant realignmentVCF parsing test casesTest playgroundCreates a simple "genome" for testing: